repp stands for repository-based plasmid design. It is a command line tool that is very useful to automate some steps in plasmid design. See Timmons, J.J. & Densmore D. Repository-based plasmid design. PLOS One.. Because repp is currently only available as a command line tool, the instructions below assumes some familiarity with the command line interface. Otherwise, please see this page. We assume Windows users use the Git Bash program for their command line interface.
The original repp needs a multi-FASTA format sequence to build a database and the output is in json format, which is not convenient for typical molecular cloning work flow. Cristian Goina from the Janelia Scientific Computing Software team has helped us to implement several important i/o features to adapt for our typical cloning work flow, including building a database from a directory of plasmid seuqences in FASTA or GenBank format, re-using existing primers, and outputting convenient csv format spreadsheets.
1. (Optional) Install and set up Git
Git is a powerful tool for version control. You don’t need Git for installing and using repp, but I encourage you to learn about it if unfamiliar. I highly recommend the Software Carpentry Lesson for Git.
-
Learn basic concepts of Git here.
-
Install Git.
- If you are using a new Mac, you probably have a quite new version of Git installed. Check by typing
git --versionin your terminal. If the version number is close to the current version, you can just use the pre-installed version. - Otherwise, follow instructions here to install Git on Windows, Mac or Linux systems.
- If you are using a new Mac, you probably have a quite new version of Git installed. Check by typing
-
Set up Git on your computer.
2. Install repp dependencies: go, primer3, and blast.
-
Skip to the next step if you are updating
repp.-
Install
go(version >= 1.19) following instructions here. -
Install
blast:- Go to the NCBI website to download the BLAST+ software.
- From this website, follow this ftp download link.
- For Mac (M1 or M2 chip OK), download “ncbi-blast-2.13.0+.dmg” for installation.
- (Optional but good practice) Check the md5 sum of the downloaded installation package by
cdinto the download folder and runmd5 ncbi-blast-2.13.0+.dmg. Make sure the md5 sum matches the ncbi-blast-2.13.0+.dmg.md5 in the ftp download list. - Open the dmg file to install blast.
- Mac will warn you about this file is from “unidentified developer” and cannot be opened. You will need to go to “Security and Privacy” settings and click “Open Anyway” to open this installer.
- Check whether installation is OK by running
which blastn, which should print out the path to theblastnprogram (e.g., /usr/local/ncbi/blast/bin/blastn).
- (Optional but good practice) Check the md5 sum of the downloaded installation package by
- For Windows, download “ncbi-blast-2.13.0+-win64.exe”
- (Optional but good practice) Check the md5 sum of the downloaded installation package by
cdinto the download folder and runmd5sum ncbi-blast-2.13.0+-win64.exein Git Bash. Make sure the md5 sum matches what is listed in ncbi-blast-2.13.0+-win64.exe.md5 in the ftp download list. - Open the exe file to install blast.
- Check whether installation is OK by running
blastn -hin Git Bash, which should print out the help message of the blastn program.
- (Optional but good practice) Check the md5 sum of the downloaded installation package by
- Go to the NCBI website to download the BLAST+ software.
-
Install
primer3.- If you use Git, run
git clone https://github.com/primer3-org/primer3.git. - If you don’t use Git, go to the Primer3 GitHub page, click on the green button
CodeandDownload ZIP. Unzip it. - For Mac:
-
Assuming the source code of
primer3is in the Downloads folder, run the following to compile, test, and installprimer3:cd ~/Downloads/primer3/src make make test sudo make install -
Check whether installation is OK by running
which primer3_core, which should print out the path to theprimer3_coreprogram (e.g. /usr/local/bin/primer3_core).
-
- For Windows:
- Download and install TDM-GCC MinGW Compiler.
-
(Optional) Assuming the source code of
primer3is in the Downloads folder, run the following to compile and testprimer3:cd ~/Downloads/primer3/src mingw32-make TESTOPTS=--windows - Copy the “primer3/src” folder that contains the compiled binaries to your preferred location, e.g., “C:\Program Files\primer3\src”.
- Add the above folder to your
PathEnvironment Variable.- Open Start Menu then type
Advanced system settingsand press Enter. - Click
Environment Variables. - Select
Pathin the variable list and clickEdit...to add the above directory.
- Open Start Menu then type
- If you use Git, run
-
3. Install the Janelia SciComp version of repp
- If you use Git, run
git clone https://github.com/JaneliaSciComp/repp.git. - If you don’t use Git, go to the Janelia SciComp GitHub page, click on the green button
CodeandDownload ZIP. Unzip it. -
Assuming the source code of
reppis in the Downloads folder, run the following to compilerepp:cd ~/Downloads/repp/cmd/repp go build - The above generates an executable in the same folder.
- For Mac, run
sudo mv repp /usr/local/bin/.to move the executable to/usr/local/binor your preferred location. Type your password to give permission if prompted. - For Windows, copy the “repp.exe” file to your preferred location, e.g., “C:\Program Files\repp”. Add this folder to your
PathEnvironment Variable.- Open Start Menu then type
Advanced system settingsand press Enter. - Click
Environment Variablestowards the bottom of the dialogue. - Select
Pathin the variable list and clickEdit...to add the above directory.
- Open Start Menu then type
- For Mac, run
- Check whether installation is OK by running
where repp, which should print out the path to thereppprogram (e.g. /usr/local/bin/repp).
4. Use repp in your plasmid design work flow
-
Download repp_test.zip for testing.
-
(Optional) Add sequence databases from remote repositories (e.g., Addgene, iGEM, DNASU).
As direct synthesis of DNA fragments becomes more affordabl (e.g., by Twist Bioscience), the advantage of PCR amplification from existing plasmids has become less and less important. Moreover, acquiring a plasmid from repositories introduces additional time cost. If you have access to basic plasmid backbones, you may omit this step.
The original
reppauthor has assembled FASTA files from Addgene, iGEM, and DNASU, and made it available from the S3 bucket. Run the following command to download and add them to thereppsequence database on your computer:# download repository FASTA files for db in igem addgene dnasu; do curl -o "$db.fa.gz" "https://repp.s3.amazonaws.com/$db.fa.gz" gzip -d "$db.fa.gz" done # add sequence DBs with the cost of ordering a plasmid from each source repp add database --name igem --cost 0.0 < igem.fa repp add database --name addgene --cost 85.0 < addgene.fa repp add database --name dnasu --cost 99.0 < dnasu.fa -
Add sequence databases from local collections.
Put all sequence files (GenBank or FASTA format) in a directory. In the repp_test example, this directory is called “lab-plasmid-collection”. Run the following command to add them:
# -n is shorthand for --name # -c is shorthand for --cost # run "repp add database --help" for more options repp add database -n lab -c 0 lab-plasmid-collectionNote that adding sequence database is a one-time operation that stores the database files in a hidden directory. Adding a new directory to a database with the same name(e.g., -n lab) will overwrite it.
- On Mac, they are in “~/.repp/dbs”.
- On Windows, they are in “C:/users/username/.repp/dbs”.
-
(Recommened) Organize your primer database for re-using primers.
It is highly recommended to create a shared primer database among your group for re-using primers. The primer database parameter
-maccpets either a single spreadsheet or a folder containing multiple spreadsheets. If a required primer is found in the primer database, it will re-use this primer and prefix the primer id with an asterisk to indicate that it’s already in the lab collection.It is preferred to maintain archived primers and active priemrs in separate spreadsheets. In labs with multiple users, each user can have their own archived and active primers, with user-specific primer prefix. You can specify your primer prefix with
-x.The primer database spreadsheet must have the “primer_id” and “sequence” columns, and optionally additional columns for other information.
In the repp_test example, the “primer_database” folder has two spreadsheets: “1_archived_primer.csv” and “2_active_primer.csv”. This is how the “2_active_primer.csv” looks like:
primer_id sequence oS41 ACTTTTCGGGGAAATGTGCG oS42 GTGAGCAAAAGGCCAGCAAA oS43 GTGCCAGTGGTCTCTTGTTG oS44 CTATTACCATGGTGATGCGGTTTTGGCAGTAC oS45 ACTGGATCTCTGCTGTCCCT oS46 GGCATGGACGAGCTGTACAA oS47 TTCAAGTCTGTTCACACGCC oS48 CTTGCAGCAGATTCAGACCC oS49 CCACGTGGGCTTTATCTTCC -
(Optional) Organize your fragment database for re-using synthesized fragments.
Following the same logic of re-using primers, you may also wish to re-use synthesized fragments. For this purpose, you can organize your synthesized fragment database similarly as the primer database. Similar to the primer database parameter, the synthesized fragment database parameter “-s” can also accpet a single spreadsheet or a folder containing multiple spreadsheets.
In practice, however, we found in most cases it is quite unlikely to re-use synthetic fragments. Thus, we stopped doing this by default. We leave this as an option in case it might be useful for you.
In the repp_test example, the “fragment database” folder has two spreadsheets: “1_archived_frag.csv” and “2_active_frag.csv”. This is how the “2_active_frag.csv” looks like:
frag_id sequence syn4 atgtca…(long sequence)…ataacc syn5 CAGGGA…(long sequence)…TCAAAG -
Put together the target plasmid sequence in GenBank format.
In the repp_test example, the target plasmid is called “pW256.gb”.
We use ApE (A plasmid Editor) to edit and annotate DNA sequences. ApE is a free software written by M. Wayne Davis from University of Utah. You can use whatever software you prefer, but make sure to save it in GenBank format. Note that the default .ape file uses GenBank format and is compatible with
repp. -
Run the
repp make sequencecommand.The simpliest command is
repp make sequence -i pW256.gb, which uses all available databases (in this case, “igem,addgene,dnasu,lab”) and default parameters.To specify the database (e.g., only use local collection “lab”), use
repp make sequence -i pW256.gb -d lab.To also specify the primer database and a synthesized fragment database, use
repp make sequence -i pW256.gb -d lab -m primer_database -s frag_database. This result in two csv files: “pW256.output-strategy.csv” and “pW256.output-reagents.csv”.The first 5 columns of “pW256.output-strategy.csv” is shown below. Other columns (Match Pct, GC%, 50 low GC%, 50 high GC%, and Homopolymer) can help users decide whether certain fragments may be difficult to PCR or to synthesize.
# 2025/09/22 23:56:15 # Solution 1 # Fragments:2 (1 - pcr 1 - synth) # Cost: 291.980000 Adjusted Cost: 291.980000 Frag ID Fwd Primer Rev Primer Template Size pW256_pcr1 oS46 oS50 pW222 7824 pW256_syn1 N/A N/A N/A 3639 The “pW256.output-reagents.csv” is shown below. The priming region and Tm columns can help users optimize PCR amplification conditions.
# Solution 1 Reagent ID Seq Priming Region Tm *oS46 GGCATGGACGAGCTGTACAA GGCATGGACGAGCTGTACAA 60.39 oS50 GCTCTAGAACCGGTCCTGTG GCTCTAGAACCGGTCCTGTG 59.83 pW256_syn1 ACACAGG…TGTACAAG N/A N/A Note that pre-existing primers and synthesized fragments are marked with an asterisk. The IDs of new primers and synthesized fragments are incremented from the maximum number with the specified primer prefix found in the database.
Sometimes
reppgenerates multiple solutions, because some solution may have a larger cost but fewer fragments. You can choose your favorite solution to move forward.If you choose a strategy with synthetic fragment, it is good practice to enter the synthetic fragment sequence(s) in Twist to test whether they are OK for synthesis. Sometimes they could be rejected due to repeats and/or extreme GC contents. In those cases, you may need to adjust the cloning strategy accordingly.
-
Order new reagents in the “output-reagents.csv” file.
For primers, copy the first two columns of new primers (those not marked with an asterisk) from the to the active primer database spreadsheet. These can then be ordered from your preferred supplier; our standard choice is IDT.
Likewise, for synthesized fragments, copy the first two columns of the new entries (again, those without an asterisk) to the active synthesized fragment database spreadsheet. You can order these from your favorite DNA fragment provider. We recommend Twist for its exceptionally low cost of 9 cents per base pair.
-
PCR amplification and Gibson Assembly.
Print the table in “output-strategy.csv” for bench work reference.
Follow this protocol for PCR amplification using a high-fidelity DNA polymerase.
Follow this protocol for assembling the fragments using Gibson Assembly.